WEB-THERMODYN is a web-based program that analyzes DNA sequences and computes the DNA helical stability, i.e. the free energy required to unwind the two strands of the double helix. A helical stability profile across a selected DNA region or the entire sequence is generated by sliding window analysis. WEB-THERMODYN can predict low helical stability regions present at regulatory regions for replication and transcription. An example of the program output and information for the user can be seen in a publication by Huang & Kowalski, 2003.

WEB-THERMODYN requires the input values of temperature (°C), salt concentration or monovalent cation concentration (mM), name of the DNA molecule, the base sequence of the DNA of interest, the shape of the DNA (linear or circular), the "window" size, the step size of "sliding" and the number of minimal free energy windows that will be marked.

The sliding window approach for analyzing a DNA sequence Query is illustrated in an example below for Window size = 10 and Step size = 5:

.         .         .         .  Query:   AATTCTTAAAATTAGTTATAATATATATATATATACCTATATTGGTATAT  window1: __________  window2:      __________  window3:           __________  window4:                __________  ...                               ...

The free energy value (G) of each "sliding window" is computed using the Nearest-Neighbor-Thermodynamics Algorithm described below. The start position and the corresponding free energy value for each window are output to a table. The table also provides a bar graph profile of the DNA helical stability at each window position. The same data are also output to a ASCII txt file for the convenience of further analysis using other software such as SlideWritePlus or Microsoft EXCEL. Other program output includes the name of the DNA molecule and paramenters entered by the user such as DNA sequence, shape, window size, step size, number of minima marks, temperature, and salt concentration. Also output are the length of the molecule, number of G or C bases, and GC composition (GC %). A similar, PC-based program, THERMODYN was developed and described by Natale and Kowalski. (Natale et al, 1992; Natale et al, 1993)

The principles upon which the Nearest-Neighbor-Thermodynamics Algorithm is based are:

Under a given set of solution conditions the relative stability of a DNA duplex structure depends on the primary sequence. More specifically, the stability of a DNA duplex depends primarily on the identity of the nearest-neighbor (NN) bases.

 

Ten different nearest-neighbor (NN) interactions are possible in a Watson-Crick DNA duplex structure: AA/TT; AT/TA; TA/AT; CA/GT; GT/CA; CT/GA; GA/CT; CG/GC; GC/CG; GG/CC. The standard (under conditions of 25°C and 1M monovalent cation) entropy (S°) and standard enthalpy (H°) values of all of these 10 interactions are available from the thermodynamic library reported by Breslauer & Marky (1986).

 

The standard entropy value (S°) of a duplex DNA structure is determined by the sum of the standard entropy values of all of its nearest neighbors. Similary, the standard enthalpy (H°) of a duplex DNA structure is determined by the sum of the standard enthalpy values of all of its nearest neighbors.

H° = SUM {(frequency of NN)*(H° of NN)}

S° = SUM {(frequency of NN)*(S° of NN)}

The melting temperature of the duplex can then be calculated by the following formula once we have determined the S° and H°.

Tm = (H°/S°) + 18log[monovalent cation]

Note that the Tm of interest to us is for local strand separation within a larger duplex DNA and is therefore independent of DNA concentration.

Subsequently, the free energy value (G) of the duplex can be calculated by the following formula:

G =H°[1-(T/Tm)]